Production Of Somatostatin By Recombinant Dna Technology

Halki Diabetes Remedy

Home Diabetes Cure

Get Instant Access

AATTCGCTAAAGGCTTTATGCGCTG

GCCATTTCCGAAATACGCGACTTAA

foreign DNA /

AATTCGCTAAAGGCTTTATGCGCTG I AATT

GCCATTTCCGAAATACGCGACTTAA

ligase enzyme: pastes DNA fragments together

Figure 7.1 The cut and paste operations of recombinant DNA technology. First, a restriction enzyme is used to snip up native DNA from a source such as human tissue. Foreign DNA from another source is also snipped. The snipping operations create "sticky" ends on the restriction fragments. Then, the native and foreign DNA fragments are mixed together in a test tube with ligase enzymes. The sticky ends of DNA clasp one another, and the ligase chemically seals the strands, thereby generating a recombinant DNA molecule.

ligases, that perform the reciprocal task of joining fragments of DNA into longer strands. Just as medical surgeons use sutures and glues to mend the slashes produced by their scalpels, so molecular surgeons now employ DNA ligases in conjunction with restriction enzymes to perform the cut-and-paste micro-operations of "recombinant DNA" technology. Such is the near universality of basic molecular processes across life that restriction enzymes and ligases can be used collaboratively to clip and surgically join genes from even the most distantly related organisms. Indeed, one of the most common procedures in the production of transgenic organisms is to cut a particular gene from the genome of a higher animal, such as a human, and splice it into a bacterium (see Figure 7.2). Quite miraculously, the transgene often continues its normal function in this novel biological environment.

In the first commercial application of this approach, the human gene for insulin hormone was transferred to E. coli, a bacterium normally inhabiting the human gut but equally happy when grown in laboratory culture in the appropriate medium. Using the recombinant DNA procedures just discussed, the insulin gene was spliced into the microbe and successfully expressed there, producing the human insulin polypeptide. Then, huge bacterial cultures (fermentation vats) mass produced this medically important pharmaceutical product. This is possible because the human insulin gene, once inside E. coli, is multiplied to vast numbers during the course of normal genetic replication by the microbial host. Nearly unlimited amounts of insulin to treat human diabetes can be extracted from these cultures.

The genetic donors in such transgenic manipulations need not be humans. A bovine gene for somatotropin (BST) that greatly boosts milk yield in cows recently was introduced into E. coli. The BST hormone, now microbially manufactured, promises to make a substantial contribution to the dairy industry.

Also, the transgenic recipients of human's or other species' genes need not be microbes. One of the first attempts to engineer a transgenic mammal involved transfer of the human gene for growth hormone into mice. Although only a small fraction of the mice accepted the gene and transmitted copies to their offspring, those individuals grew much larger and became known as super-

Synthesis Somatotropin Flowchart

Figure 7.2 Simplified flow chart for two of the major routes to human genetic engineering. Cloning of a particular gene usually is initiated by isolating the gene and inserting it into a bacterial plasmid. The recombinant bacterium then divides and multiplies, producing multitudinous copies of the gene. In some cases, the human transgene within the bacterium may produce a therapeutic protein that can be isolated in large quantities and administered to treat human disabilities. In other cases, the cloned gene may be inserted into a virus that can infect human cells, thereby permitting introduction of the human transgene itself into a patient.

Figure 7.2 Simplified flow chart for two of the major routes to human genetic engineering. Cloning of a particular gene usually is initiated by isolating the gene and inserting it into a bacterial plasmid. The recombinant bacterium then divides and multiplies, producing multitudinous copies of the gene. In some cases, the human transgene within the bacterium may produce a therapeutic protein that can be isolated in large quantities and administered to treat human disabilities. In other cases, the cloned gene may be inserted into a virus that can infect human cells, thereby permitting introduction of the human transgene itself into a patient.

mice. One of the first anticipated commercial successes of this approach is likely to involve the protein a-1 antitrypsin (AAT), which is useful in the treatment of emphysema and of inherited AAT deficiency, a common genetic disorder affecting some 40,000 Americans. Scientists have engineered sheep carrying the human AAT gene, and have purified AAT from their milk in quantities sufficient to suggest that the worldwide human demand for this therapeutic protein might be satisfied by a transgenic flock of as few as a thousand animals. In the near future, expanded applications of such genetic "pharming" procedures might use domestic animals such as cows, sheep, goats, and rabbits as living transgenic bioreactors to produce, in their milk, mass quantities of therapeutic human proteins.4

Bacterial fermentation and mammalian pharming of human genes each have technical advantages and weaknesses. The former usually is simpler because bacteria are cheap and easy to grow, and because the gene transfers often are easier to accomplish. Bacterial cells naturally carry tiny circles of DNA called plasmids (see Figure 7.2 on p. 175) that serve as convenient vectors (miniature Trojan horses) for introducing a mammalian transgene into a bacterium and monitoring for its presence. On the other hand, bacteria tend to do a poor job of producing mammalian protein products from lengthier or more complicated transgenes, such as that encoding human hemoglobin. In human cells and those of other higher animals, many synthesized proteins are elaborated biochemically in ways that fall outside the capabilities of the molecular machinery of prokaryotic microbes.5 Thus, bacteria remain unsuitable as hosts for the proper expression of many mammalian transgenes.

Genetic pharming in mammals such as sheep and goats also has technical limitations, notably the difficulty and cost of establishing a transgenic strain. Several approaches are employed. In one popular technique that requires a keen eye and a steady hand, a fertilized egg first is removed from an animal and, under a microscope, the desired gene is physically microinjected into the egg's nucleus, using a tiny hypodermic needle. The egg then is implanted into the female's uterus. In a small percentage of attempts, the injected transgene integrates into a chromosome of the egg and becomes expressed and heritable, both in the somatic cells of the developing individual and eventually in any of her progeny. Although this approach is used widely, the expense and operational difficulties remain considerable, and a goat which successfully received a transgene can be worth literally tens of thousands of dollars.

A second approach capitalizes upon the infectious properties of viruses.6 In cut-and-paste procedures similar to those described earlier for bacterial plasmids, a gene in this case is transferred to a virus, which then becomes the genetic carrier that delivers the transgene to mammalian host cells (see Figure 7.2). If all goes well, the gene is expressed properly in its new environment. Viruses have been the molecular delivery systems employed most widely in the early years of human gene therapy. Viruses also serve as a reminder that recombinant DNA technologies (broadly defined) are hardly new on the evolutionary stage. Rather, such recombinant methods were invented by nature hundreds of millions of years ago, and are employed naturally whenever an infectious virus integrates into a host genome.

Additional DNA delivery systems are available to human biotechnologists. Somatic cells such as those in blood or bone marrow can be removed from an individual, genetically engineered by recombinant DNA techniques similar to those already mentioned, and returned directly to the patient. Another technique called electroporation takes advantage of the charged nature of DNA molecules to transfer genetic material across cell membranes under the influence of an electric current. One available gene delivery system, particle bombardment, sounds like something out of Star Wars. In this approach, DNA-coated metallic projectiles, or microbullets, are fired into recipient cells by high pressure air guns that resemble Saturday night specials. Although this method works well for injecting genes into plant cells,7 the muzzle velocities required have precluded application of this technique to relatively fragile animal cells.

Was this article helpful?

0 0
Supplements For Diabetics

Supplements For Diabetics

All you need is a proper diet of fresh fruits and vegetables and get plenty of exercise and you'll be fine. Ever heard those words from your doctor? If that's all heshe recommends then you're missing out an important ingredient for health that he's not telling you. Fact is that you can adhere to the strictest diet, watch everything you eat and get the exercise of amarathon runner and still come down with diabetic complications. Diet, exercise and standard drug treatments simply aren't enough to help keep your diabetes under control.

Get My Free Ebook


Post a comment