Production Of Somatostatin By Recombinant Dna Technology

Synthesis Somatotropin Flowchart

AATTCGCTAAAGGCTTTATGCGCTG I AATT ligase enzyme pastes DNA fragments together Figure 7.1 The cut and paste operations of recombinant DNA technology. First, a restriction enzyme is used to snip up native DNA from a source such as human tissue. Foreign DNA from another source is also snipped. The snipping operations create sticky ends on the restriction fragments. Then, the native and foreign DNA fragments are mixed together in a test tube with ligase enzymes. The sticky ends of DNA clasp one...