Aging and Death

Senescence and aging, used interchangeably here, are defined as a persistent decline in the survival probability or reproductive output of an individual because of internal physiological deterioration. In other words, we and other organisms become inherently more fragile as we age. It is important to distinguish the progressive and inherent dilapidation of aging from nonaccelerating sources of injury or death such as lightning strikes, car crashes, or falls from cliffs. Consider an analogy to a...

Meaning

Devoid of ultimate meaning, life means all the more. God, insisted the antelope, is a runner, swift and free, who loves to leap and race with the wind. She is a great tree, murmured the willow, a part of the world always growing and always giving . . . She is a hunter, roared the lion. God is gentle, chirped the robin. He is powerful, growled the bear. he science of evolutionary genetics, in contrast to other belief systems, is descriptive rather than prescriptive of human affairs. Although...

The Doctrines of Biological Science

Williams, Natural Selection Domains, Levels, and Challenges (New York Oxford University Press, 1992). 2. In the 1960s, a God is dead movement swept across the United States, fueled by the perception that a living god would not so neglect the plight of humans. See the philosophical discussions in J. B. Metz, ed., Is God Dead (New York Paulist Press, 1966). Some have thought instead that a well-intentioned god is overmatched. As expressed in subway graffiti, God is alive and well but...

Genetic Maladies

A recent biography of Sir Archibald Garrod is A. G. Bearn, Archibald Garrod and the Individuality of Man (New York Oxford University Press, 1993). 2. Given the huge numbers of DNA polymorphisms already observed in human populations, the number of potential genotypes is astronomical. Suppose that a mere two hundred polymorphisms were present (more than an order of magnitude fewer than have been documented to date), each with the minimum possible two alleles. Under the logic of Mendelian...

Genetic Determinism and the Cyril Burt Affair

Few topics in biological determinism have been more controversial than that of the measurement and interpretation of variation in human cognitive ability. In 1909, a young British scientist named Cyril Burt published the first in a series of highly influential papers promoting the notion that variation in human intelligence was male bonding locus backyard football beer-belly biathlon golf, poker vehicular attraction cluster (VRROOM) gadgetry locus (GAD) power tools (PT) personal computers (MAC)...

New Lords of Our Genes

I recommend this book as an introduction to the scientific history of genetic engineering (New York Norton, 1995). 2. Not all infectious plagues are behind us. Outbreaks such as AIDS, various influenzas, Legionnaires' disease, toxic shock syndrome, and Lyme disease provide powerful reminders that modern societies remain subject to major disease epidemics. 3. For example, the restriction enzyme EcoRI, named after the bacterium Escherichia coli from which it was isolated, cleaves duplex DNA...

Reproductive Tinkering

Can a sterile man, unable to produce mature sperm, nonetheless father healthy children Thanks to breakthroughs in human reproductive technology, the surprising answer is yes. A recent clinical case involved an infertile man suffering from azoospermia, a common condition often of genetic origin (involving, for example, microdeletions in the Y chromosome). Fatherhood was accomplished by a medical procedure, intra-cytoplasmic sperm injection (ICSI), which involves the isolation and microinjection...

The Atomization of Human Behavior

Although genetic influences on many aspects of human cognition are mediated and modulated by culture, one research tradition is to consider the possibility of more direct mechanistic connections of particular behavioral traits to particular genes. Such causal links, if identifiable, would once and for all establish direct genetic contributions for such traits, and also might offer prospects for interventions of the sort described in the next chapter. Initial research has focused on attempts to...

Production Of Somatostatin By Recombinant Dna Technology

Synthesis Somatotropin Flowchart

AATTCGCTAAAGGCTTTATGCGCTG I AATT ligase enzyme pastes DNA fragments together Figure 7.1 The cut and paste operations of recombinant DNA technology. First, a restriction enzyme is used to snip up native DNA from a source such as human tissue. Foreign DNA from another source is also snipped. The snipping operations create sticky ends on the restriction fragments. Then, the native and foreign DNA fragments are mixed together in a test tube with ligase enzymes. The sticky ends of DNA clasp one...

Genetic Sovereignty

Such possibilities certainly were not lost on Charles Darwin, who in 1872 published The Expression of the Emotions in Man and Animals (reprinted by the University of Chicago Press, 1965), a book that attempted to extend principles developed in On the Origin of Species to the fields of human ethology and psychology. 2. See R. C. Lewontin, S. Rose, and L. J. Kamin, Not in Our Genes (New York Pantheon Books, 1984). 3. L. S. Hearnshaw, Cyril Burt Psychologist (London Hodder and Stoughton, 1979)....

The Chromosomal House of Horrors

To emphasize the troubling scientific and providential enigmas presented by human genetic disorders, and to illustrate the pervasive scope of conditions affected by pernicious genes, I will next describe briefly a few of the more common or gruesome afflictions from the morbid encyclopedia of the human genome. For each, mutations in one or more genes on a human chromosome result in the debilitating diseases mentioned. Chromosome 1 hypophosphatasia This genetic defect in skeletal mineralization...