Rapid Reflux Relief

Rapid Reflux Relief

Mom Conference

Mom Conference

Keto 28 Review

Keto 28 Review

Organomercury and autism

Autism is a distressing condition and five children in every 10000 are afflicted with it, and of these the ratio of 4 boys to 1 girl.* What causes a seemingly normal baby to develop autism is still unknown, but many in the USA believe that mercury is the cause. In the late 1990s it was accused of causing attention deficit syndrome, stammering, and especially autism. Some thought that thimerosal was to blame. This is a mercury-containing antibacterial agent which was added to vaccines to...

Thallium in the human body

We all have a little thallium in our body, probably no more than half a milligram, and the level in blood is only 0.5 ppb. The average person takes in about 2 g of thallium a day as part of his or her diet this accumulates in the body over time and most ends up in the skeleton. Indeed thallium finds its way into all tissues except fat, and it can even pass the placental barrier. There is no biological role for thallium although some marine organisms appear deliberately to concentrate it, but...

Mistaken Styles of Life

Not all styles of life are equally desirable. Sometimes, early in life, people develop strategies for improving their situations that are, in the long run, maladaptive. For example, a child may become overly dependent on doting parents or overly rebellious. Adler referred to these as mistaken styles of life. He listed several types, which we shall examine here. Ruling Type. Ruling types seek to dominate others. They may actively confront life's problems in a selfish way, becoming delinquents,...

Benign Vulvar Nodules Or Tumors

In most cases, excision of solid lesions is diagnostic as well as therapeutic. Pigmented vulvar lesions include lentigo and nevi. Approximately 2 to 5 of melanomas, but only 0.1 of nevi, are located on the vulva, leading theories that vulvar nevi are at increased risk for malignant transformation (43). As such, detection and careful evaluation of vulvar nevi are critical. The benign lesions of seborrheic keratosis do not require treatment. However, excision can be performed at the patient's...

Volatile Acidtoalkalinity Ratio

The range of acceptable volatile acid-to-alkalinity ratios is 0.1-0.2. An acceptable ratio may be obtained by adjusting volatile acid concentration, alkalinity concentration, or both concentrations. Reducing or terminating feed sludge to the digester also helps to lower the volatile acid-to-alkalinity ratio. If feed sludge cannot be reduced or terminated, the use of chemicals for alkalinity adjustment is required. An unacceptable volatile acid-to-alkalinity ratio is usually the first warning of...

Symptoms and detection of strychnine poisoning

The effects of strychnine usually appear rapidly, within ten to fifteen minutes. As with most poisoning cases, the victim appears to be well and in good health, and then suddenly falls ill following the eating or drinking of something or the taking of a preparation or medication. Within minutes the victim will complain of stiffness, often in the back of the neck. Tremor and twitching start, followed by convulsions. Occasionally there is only one massive convulsion before death, but usually...

Diagnostic investigations

The main and nearly universal symptom of SSc is skin sclerosis. Still, in some cases patients with characteristic serologic, visceral, and vascular changes lack skin thickening, which are then termed systemic scleroderma sine scleroderma. Several studies have suggested that the extent and progression of skin sclerosis is associated with mortality and internal organ involvement (Clements et al., 2000 Steen and Medsger, 2001). The most widely used assessment method for skin involvement is the...

How DDT works and why it is toxic to insects but not mammals

The mechanism by which DDT acts is to disturb the function of nerves in the insect. Nerves in both insects and humans work by allowing an electric current to move down them. This action potential, as it is called, depends on the movement of two metal ions, sodium and potassium, across the membrane of the nerve, and involves channels for the sodium being opened very briefly. DDT interacts with the sodium channel in the insect nerve and retards its closure. This means that the flow of sodium and...

When Healthy Sinuses Become Blocked

While sinus anatomy can be likened to a house, sinus function runs more like a car. With an automobile, you know there's a lot of firing and whirring going on under the hood, but as long as the car runs OK, you tend not to think about it. Then, after months or years without any problems, you start to hear a strange knocking sound. You hope it will go away, but instead the engine conks out on the highway, stranding you on your way to work. Similarly, when your sinuses are healthy, you breathe in...

Sex Tips To Drive Him Crazy: How To Be A Sex Goddess And Blow His Mind

Sex Tips To Drive Him Crazy: How To Be A Sex Goddess And Blow His Mind

Juicing for your manhood: Cure Ed Review

Juicing for your manhood: Cure Ed Review

The Big Book of Home Remedies

The Big Book of Home Remedies

The strange death of King Charles II

King Charles II was not an alchemist as such, but he was very interested in science and especially 'chymistry'. He had a laboratory built in the basement of his palace at Westminster and there, with the aid of one or two assistants, he spent time smelting and refining mercury, and indeed he became accomplished in the experimental techniques of the alchemists. Charles had his laboratory staff extract mercury from cinnabar and even distil it. No doubt his aim was to transmute base metals into...

Contact Dermatitis of the Vulva

Contact dermatitis of the vulva is an inflammatory condition that can occur at any time during a woman's life in response to primary exposure to an irritant or from an allergic response to an irritant. Contact dermatitis also can occur secondary to another condition, such as a vaginal yeast infection or urinary and or fecal incontinence. Common causes of irritative contact dermatitis of the vulva include laundry detergent, fabric softeners, body soaps, perfumes, hygienic wipes, and douches. In...

About the Friendliness Scale

Psychologist John Reisman was motivated to construct his test because he conceptualized friendliness slightly differently from the authors of other, similar tests. Reisman argued that existing definitions of this trait were virtually indistinguishable from other personality characteristics such as outgoingness or agreeable- ness. He argued that friendliness included four qualities, those represented by the subscales on his test Self-Concept, Accessibility, Rewardingness, and Alienation....

The Emotional Motivational Repertoire

Staats's Three Basic Behavioral Repertoires BBRs Examples of Related Personality Tests Emotional responses to social interactions with friends and family Sexual arousal Enjoying work and recreation Emotional responses to music and art Type-A behavior1 Feeding Toilet training Writing Aggressive behavior Active-passive behavior Behavior judged masculine or feminine Intelligence tests many items Reading readiness tests Interest tests Strong Vocational Interest Blank Values tests...

Personal Orientation Inventory

The Personal Orientation Inventory POI Shostrom, 1964 is a 150-item multiple-choice inventoiy that provides two primary scores derived from Maslow's theory. The Inner Directed Supports scale measures the degree to which the subject provides his or her own support as opposed to turning to others . The Time Competence scale measures the degree to which the subject lives in the present. In addition, there are sub-scales to measure self-actualizing values, existentiality, feeling reactivity,...

How Does Epilepsy Affect Daily Life

Most people with epilepsy lead outwardly normal lives. Approximately 80 percent can be significantly helped by modern therapies, and some may go months or years between seizures. However, epilepsy can and does affect daily life for people with epilepsy, their families, and their friends. People with severe seizures that resist treatment have, on average, a shorter life expectancy and an increased risk of cognitive impairment, particularly if the seizures developed in early childhood. These...

The Flavr Savr Tomato

In May 1994, consumers were introduced to genetic engineering's first ready-to-eat produce the Flavr Savr tomato. The FDA had just ruled that the two extra pieces of recombinant DNA that Calgene Inc. had manipulated into this cultivar posed no appreciable health risks, so these GM tomatoes were as safe for human consumption as their nonengineered cousins. Actually, the FDA was not obliged by law or policy to pass premarket judgment on these plants. Rather, Calgene (later purchased by Monsanto)...

Circumscribed Changes in the Renal Pelvis and Renal Sinus

Table 49 Circumscribed changes in the renal pelvis or renal sinus Anechoic or hypoechoic Isoechoic or echogenic Parapelvic cyst solitary, multiple, p. 284 Hemorrhagic cyst p. 287 Sinus lipomatosis p. 284 Pyelocalyceal stone p. 288 Parenchymal bands, hypertrophic renal columns Foreign body drainage tube, p. 288 p. 284 Inflammatory tumor, liquefying tumor p. 287 Xanthogranulomatous pyelonephritis p. 287 Carcinoma of the renal pelvis p. 287 Renal cell carcinoma, metastasis p. 287 n Solitary...

Endocytic Function of PSMA

Prostate-specific membrane antigen, like other cell surface receptors, undergoes inter-nalization constitutively, and such spontaneous internalization is enhanced threefold in a dose-dependent manner by PSMA-specific monoclonal antibody J591 32 . It has been shown very clearly biochemically by using biotinylated cell surface PSMA followed by internalization of the protein , by immunofluorescence analysis or immunoelecton microscopy, that PSMA or the PSMA-antibody complex undergoes...

Hard On Demand Review

Hard On Demand Review

High Blood Pressure Exercises Review

High Blood Pressure Exercises Review

Anatomy Of The Lower Extremity Veins

Thorough knowledge of the fascial compartments of the leg is a prerequisite of understanding the relationship between superficial and deep veins. The fascia surrounding the calf and thigh muscles separates two compartments the superficial compartment, consisting of all tissues between the skin and the fascia, and the deep compartment, which includes all tissues between the fascia and the bones (see Figure 2.6).11 Superficial veins run in the superfical, deep veins in the deep compartments....

Differential diagnosis of papulosquamous SCLE

The diseases, which we may consider in the differential diagnosis with the papulosquamous pattern of SCLE are psoriasis and polymorphic light eruption. 3.3.1. Psoriasis vs papulosquamous SCLE Psoriasis is a chronic inflammatory disorder characterized by the presence of erythematous scaling plaques that in some cases can resemble SCLE. Differential features are a thicker scaling, with a silvery, micaceous appearance Fig. 9 and a different distribution of psoriasis plaques that predominantly...

Clinical Aspects Of Iliocaval Obstruction

The clinical presentation of inferior vena cava occlusion comprises a wide spectrum of signs and symptoms of venous hypertension. The recruitment of collateral pathways may be adequate, as well as occult, and some individuals will remain symptom free. Symptomatic individuals present with edema and a variety of signs and symptoms of venous hypertension. The severity of symptoms implies inadequate collateral inflow in the face of poorly recanalized, multisegmental obstruction. Although not as...

Differential diagnosis of localized ACLE

The diseases, which we may consider in the differential diagnosis with localized ACLE, are acne rosacea, contact dermatitis and photodermatitis, seborrheic dermatitis, dermatomyositis, erysipelas, and delusion of lupus. In its early stages, rosacea may present with a purely erythematous rash on the malar areas that can be very similar to ACLE. The rash may be triggered or aggravated by heat, cold, emotions, and by the ingestion of hot drinks, alcohol, and spicy foods. Differentiating early...

Changes in the Vulva and Vagina Throughout Life

Feminine Care Clinical Sciences, The Procter & Gamble Company, Cincinnati, Ohio, U.S.A. Department of Dermatology, University of California School of Medicine, San Francisco, California, U.S.A. Aikaterini Deliveliotou and George Creatsas Second Department of Obstetrics & Gynecology, University of Athens Medical School, Aretaieion Hospital, Athens, Greece The vulva and vagina change over the course of life. The most salient changes are hormonally mediated and are linked to the onset of...

The Great Saphenous Vein

The Great Saphenous vein is scanned from the groin in proximal-to-distal direction. In the thigh, the GSV lies within the saphenous compartment (see Figure 18.5).19 The superficial fascia and the muscular fascia define the saphenous compartment and provide the typical ultrasound image of an Asian eye (see Figure 18.5c).25 Anterior and posterior accessory veins are often identified in the thigh (see Figure 18.6). These veins are often incompetent and receive reflux from the saphenous vein.19...

The Construction Corollary

According to the Construction Corollary A person anticipates events by construing their replications. (Kelly, 1955, p. 50) Like a scientist who anticipates that obsetvations will confirm a stated research hypothesis, we anticipate confirmation of our constructs (cf. Mancuso, 1998). We base our expectations of the next football game on our experiences of previous ones, of the next concert by previous ones, and so on. Events, more or less similar, occur repeatedly, and our plans for the future...

The Destructive Pessary

Vaginal pessaries were commonly used in ancient Greece. These were wool tampons soaked in a variety of substances, including opium poppies, bitter almond oil, boiled honey, sea onion, ox marrow, goose fat, rose oil, thapsia root, myrtle, coriander, cumin, marjoram, bacchar (an aromatic root), perfumes, emetics, or other substances.5 The following is a typical account of the use of a therapeutic pessary The wife of Epicrates, who lay sick near the statue of the city founder, when near her...

Accumulation of chemicals in the food chain bioaccumulation and biomagnification

Chemicals such as DDT and other organochlorine pesticides are not very soluble in water but do dissolve in fat. Therefore in animals, including humans, that are exposed to these substances the chemicals tend to be distributed into tissues containing fat. Although DDT is metabolized to some extent and some is excreted (see Chapter 2), some of it remains in animals. If exposure is repeated or continuous, accumulation occurs. For example, fish or other organisms swimming in contaminated rivers may...

Ultrasound Scanning Planes

Fig. 15 Schematic representation of typical reverberations R occurring between strongly reflective interfaces I . T transducer Fig. 16 Reverberations Longitudinal scan of the uterus and bladder B with __ superimposed parallel lines caused by 14 abdominal wall structures. Arrows IUD n Significance Reverberations are consistently present in cystic organs but may also occur in solid structures. They are always troublesome and rarely helpful. They can be eliminated by changing the direction of the...

Characteristics Of Normal Vaginal Discharge

In 1959, investigators examined a group of 113 New York City women, an unknown number of whom showed evidence of cervical or vaginal infection (19). The researchers quantified the discharge by swabbing the entire vagina during the course of an examination and measuring the weight change in the swab. The mean vaginal discharge was 0.76 g for all patients, 1.0 g for women with vaginal infection, and 0.50 g for women who had douched the day before the examination. The mean weight of vaginal...

Acute cutaneous lupus erythematosus

Acute cutaneous lupus erythematosus (ACLE) usually occurs in association with systemic manifestations preceding by weeks or months the onset of a multisystem disease (Watanabe and Tsuchida, 1995 Wysenbeek et al., 1992 Yung and Oakley, 2000). Sun exposure is a common exogenous factor to be capable of precipitating ACLE (Kuhn et al., 2001a Wysenbeek et al., 1989), and some patients even report an exacerbation of their systemic symptoms after exposure to sunlight. Furthermore, infections,...

Telangiectatic Matting

The new appearance of previously unnoticed, fine red telangiectasia occurs in a number of patients. The reported incidence varies from 5 to 75 . Reasons for the development of TM are multiple. Recovery from an ischemic injury such as closing blood vessels with sclerotherapy may produce a hypoxia-induced neovascularization. In addition, injury to endothelial cells may stimulate the release of a variety of growth factors. These responses are probably a fundamental feedback response, acting to...

Making the Diagnosis Do You Really Have Sinusitis

Unless you have prior experience with sinusitis, you may have trouble distinguishing it from other ailments, such as colds and allergies. People often mistakenly confuse the three because so many of their symptoms are similar. But they are, in fact, different entities with different causes Colds. Whereas sinusitis is caused by bacteria, colds are caused by viruses. These much smaller microorganisms invade the body's cells, where they reproduce and are eventually released into the bloodstream to...

Biographies of Robert R McCrae and Paul T Costa Jr

Robert Roger McCrae was born April 28, 1949 in Maryville, Missouri, a town of 13,000 people located about 100 miles north of Kansas City. Maryville is home to Northwest Missouri State, the town's largest employer. McCrae, the youngest of three children bom to Andrew McCrae and Eloise Elahie McCrae, grew up with an avid interest in science and mathematics. By the time he entered Michigan State University he had decided to study philosophy. A National Merit Scholar, he nevertheless was not...

What Makes a Theory Useful

A useful theory has a mutual and dynamic interaction with research data. First, a theory generates a number of hypotheses that can be investigated through research, thus yielding research data. These data flow back into the theory and restructure it. From this newly contoured theory, scientists can extract other hypotheses, leading to more research and additional data, which in turn reshape and enlarge the theory even more. This cyclic relationship continues for as long as the theory proves...

Concha Bullosa Or Silent Reflux

Acute sinusitis sinusitis that lasts three months or less adenoid lump of tissue at the back of the nose that contains cells designed to fight infection enlarged adenoids can block nasal breathing, particularly in children adenoidectomy surgery to remove the adenoids allergen substance that triggers an allergy allergic fungal sinusitis type of sinusitis caused by a reaction to fungus in the sinuses allergic rhinitis inflammation of the nasal passages caused by an allergic reaction may be...

Production Of Somatostatin By Recombinant Dna Technology

AATTCGCTAAAGGCTTTATGCGCTG I AATT ligase enzyme pastes DNA fragments together Figure 7.1 The cut and paste operations of recombinant DNA technology. First, a restriction enzyme is used to snip up native DNA from a source such as human tissue. Foreign DNA from another source is also snipped. The snipping operations create sticky ends on the restriction fragments. Then, the native and foreign DNA fragments are mixed together in a test tube with ligase enzymes. The sticky ends of DNA clasp one...

Interpersonal Trust Scale

Another example of a generalized expectancy GE that has provoked considerable interest and research is the concept of interpersonal trust. Rotter 1980 defined interpersonal trust as a generalized expectancy held by an individual that the word promise, oral or written statement of another individual or group can be relied on p. 1 . Interpersonal trust does not refer to the belief that people are naturally good or that they live in the best of all possible worlds. Neither should it be equated...

The Selfesteem Rating Scale

This questionnaire is designed to measure how you feel about yourself. It is not a test, so there are no right or wrong answers. Please answer each item as carefully and accurately as you can by placing a number by each one as follows 1. I feel that people would not like me if they really knew me well. 2. I feel that others do things much better than I do. 3. I feel that I am an attractive person. 4. I feel confident in my ability to deal with other people. 5. I feel that I am likely to fail at...

The madness of Isaac Newton

Isaac Newton was one of the greatest scientists of all time. His achievements were impressive he explained the nature of light and colour he established the theory of gravity and deduced how the solar system works he devised the laws of motion and he invented an early form of differential calculus. What is less well known is that he spent most of his time when he was Professor of Mathematics at Trinity College, Cambridge, as an alchemist. When, in 1940, the economist John Maynard Keynes opened...

Biography of Arthur Staats

Arthur Staats was born in New York in 1924, the youngest among four children. His Jewish mother, whose maiden name was Jennie Yollis, came from Tetiev, Russia. Her grandfather was a Talmudic scholar, devoted only to study. Her father, after his own study, became an atheist and radical thinker. When Staats was 3 months old, his father Frank died suddenly, several days after the family arrived in Los Angeles after a voyage through the Panama Canal his mother never remarried. Through primary and...

Postsclerotherapy Hyperpigmentation

Cutaneous pigmentation to some degree is a relatively common occurrence after sclerotherapy with any sclerosing solution. It has been reported in 11 to 80 1-3 of patients. The true incidence of hyperpigmentation is a result of many factors, including treatment technique, sclerosing solution, and concentration, as well as how the authors define pigmentation. The definition of pigmentation should be, any brown-black staining of the skin occurring after sclerotherapy, with persistent pigmentation...

Eustachian Tube Dysfunction

Because the ears, nose, and throat are all connected, it's not uncommon for problems in one area to spill over into another. One example is Eustachian tube dysfunction (ETD). Eustachian tubes are narrow passageways that connect the inside of the ears to the back of the nose in an area known as the nasopharynx (refer back to Figure 2.2). These tubes equalize the pressure between your ears and the outside atmosphere. When you feel your ears popping in an elevator or on an airplane, that's your...

Safeguarding Tendencies

Adler believed that people create patterns of behavior to protect their exaggerated sense of self-esteem against public disgrace. These protective devices, called safeguarding tendencies, enable people to hide their inflated self-image and to maintain their current style of life. Adler's concept of safeguarding tendencies can be compared to Freud's concept of defense mechanisms. Basic to both is the idea that symptoms are formed as a protection against anxiety. However, there are important...

Changes in the Portal Venous System

N In portal hypertension, the luminal size transverse diameter of the portal veins correlates poorly with the portal pressure. Thus, the diagnosis of portal hypertension relies not only on increased portal vein diameter but also on the results of CDS with spectral analysis and the assessment of flow characteristics. Definite signs of portal hypertension by CDS are flow reversal and an absence of flow. n The causes of raised portal venous pressure are classified as follows Prehepatic portal vein...

Pampered Style of Life

A pampered style of life lies at the heart of most neuroses. Pampered people have weak social hiterest but a strong desire to perpetuate the pampered parasitic relationship they originally had with one or both of then parents. They expect others to Chapter 3 Adler Individual Psychology 81 look after them, overprotect them, and satisfy their needs. They are characterized by extreme discouragement, indecisiveness, oversensitivity, impatience, and exaggerated emotion, especially anxiety. They see...

Epicondylitis tennis elbow golfers elbow

The bony prominences on the inner and outer side of the elbow are known as the epicondyles. They are the lower part of the humerus (upper arm bone) and form the attachment of muscles that move the wrist. Muscles that move the hand away from the palm (as in a backhand stroke in tennis) attach to the outer or lateral epicondyle. Those that move the hand in the palmar direction (as in a forehand stroke) attach to the inner or medial epicondyle. When these attachments become inflamed, the condition...

The case of Susan Barber

As well as being used in many suicides, paraquat has also featured in a murder case. The murder went almost undetected but for the persistence of a pathologist. The Barbers lived in Westcliff-on-Sea in Essex and had been married for over 10 years by 1981. Michael, who worked in a local factory, was unskilled and had been in trouble with the police several times. His wife, Susan, had married him at 17, already with child although, unbeknown to Michael, the child was not his. Susan continued her...

Complications Of Heparin Therapy

The main adverse effects of heparin therapy include bleeding, thrombocytopenia, and osteoporosis. Patients at particular risk of bleeding are those who have had recent surgery or trauma, or who have other clinical factors which predispose to bleeding on heparin, such as peptic ulcer, occult malignancy, liver disease, hemostatic defects, age > 65 years, and female gender. The management of bleeding on heparin will depend on the location and severity of bleeding, the risk of recurrent VTE and...

About the Multidimensional Anger Inventory

As is the case with all sciences, psychology has been guilty of its share of mistakes. One interesting example of this concerns the emotion of anger. For many years, the common wisdom was that people should express their anger, that it was unhealthy to suppress it. Freud, one of the first proponents of this view, argued that depression is anger turned inward, so clearly, it would be better to express one's anger outward to avoid the negative consequences of repressing it. This belief was...

Diseases That Cause Vulvar Pain Vulvar Vestibulitis

Vulvar pain was documented as early as 1888, by Dr. Alexander J.C. Skene in his textbook Treatise on the Disease of Women, in which he identified hyperesthesia of the vulva (21). Vulvar vestibulitis syndrome (VVS) was first described by Woodruff and Parmley in 1983 (22). The criteria for the diagnosis were described by Eduard Friedrich in 1987. His three subjective and objective criteria are (23) 1. Severe pain on vestibular touch or attempted vaginal entry 2. Tenderness to pressure localized...

Postbariatric Surgery

Given the epidemic of obesity that has af icted Americans, gastric bypass surgery its multiple variations known collectively as bariatric surgery has become increasingly popular. More than 103,000 bariatric surgical procedures were performed in 2003.75 Between 15 and 20 of patients undergoing bariatric surgery eventually seek plastic surgery once their weight has stabilized. A patient's weight must usually be stable for 1 year before plastic surgery is considered to correct skin excess....

Nuclear Grooves and Pseudoinclusions

The presence of extensive nuclear grooves is a common finding in PTC, caused by an infolding of the nuclear membrane. Nuclear grooves are present in nearly all cases of PTC, but they may be sparse in up to 25 of cases. They are often parallel to the long axis of the oval nuclei, giving a coffee bean appearance (see Figure 9.5). Nuclear grooves alone are nonspecific and can be seen in a variety of neoplastic and non-neoplastic cells, including macrophages and benign follicular cells. However,...

Core Features of Human Agency

Bandura (2001, 2004) discusses four core features of human agency intentionality, forethought, self-reactiveness, and self-reflectiveness. Intentionality refers to acts a person performs intentionally. An intention includes planning, but it also involves actions. It is not simply an expectation or prediction of future actions but a proactive commitment to bringing them about (p. 6). Intentionality does not mean that all of a person's plans will be brought to fruition. People continually change...

Sexual Fidelity and Romantic Love

Sleep around with too many people, and your lover will probably leave you. Sexual choice is not just the power to initiate relationships, but the power to end them. Our capacity for sexual fidelity, imperfect though it may be, is a result of our ancestors favoring the faithful by breaking up with the unfaithful. As David Buss has emphasized, humans have evolved specialized emotions for detecting and punishing infidelity in sexual relationships, distinct from our instincts for detecting cheats...

The Idealized Self Moving away from the Real Self

The third major neurotic adjustment strategy is to turn away from the real self toward some seemingly better (less helpless, less angry) idealized self. The real self is the alive, unique, personal center of ourselves (Horney, 1950, p. 155) and is involved in healthy psychological growth. It is the self that would have developed if we had been nurtured properly as we were developing or that we may become once we overcome our neurosis (Paris, 1999). For clarity, Horney offered a different term...

Triadic Reciprocal Causation

In Chapter 15, we saw that Skinner believed that behavior is a function of the environment that is, behavior ultimately can be traced to forces outside the person. As environmental contingencies change, behavior changes. But what impetus changes the environment Skinner acknowledged that human behavior can exercise some measure of countercontrol over the environment, but he hisisted that, hi the final analysis, behavior is environmentally determined. Other theorists, such as Gordon Allport...

Children and Sinusitis

Like adults, children can develop sinus infections. Most often, kids' infections follow on the heels of a cold, but they can also be triggered by allergies. Although the infection process is the same as in grown-ups, several factors specific to children affect the way we diagnose and treat pediatric sinusitis. First, doctors have a harder time distinguishing between a child's sinusitis and severe cold or allergies. In an infant or a young child, the only symptom of sinusitis that parents may...

Main clinical cutaneous manifestations

The spectrum of clinical vasculitis-related lesions is wide and includes erythema, purpura, papules, pustules, nodules, livedo, necrosis, ulcerations and or bullae. These different lesions are often associated, giving rise to a pleomorphic clinical picture, that is not specific to any of the systemic vasculitides, granulomatous or otherwise. Palpable purpura and petechiae are unquestionably the most frequent manifestations (Figs. 1 and 2). Lesions usually begin as tiny red macules that later...

Types of food additives

Preservatives are substances added to food to prolong their shelf life. They prevent or reduce bacterial or fungal growth. Examples of preservatives are salt, nitrites, sulphur dioxide, propionate, and benzoate. Antioxidants are added to oils and fats to stop them going rancid because of oxidative damage. They may also be added to fruits and vegetables. Examples of antioxidants are butylated hydroxytoluene, ascorbate, and a-tocopherol. Emulsifying, stabilizing, and thickening agents are added...

Child with Rapid Growth and Precocious Sexual Maturation

A 6-year-old boy was admitted to the medical center with a 4-year history of rapid somatic growth and a 6-month history of pubic hair growth. The patient was the full-term product of a normal vaginal delivery following an uncomplicated first gestation in a 34-year-old healthy female. Birth weight was 8 lb 9 oz (3.9 kg) and length 21.5 in. (54.6 cm). There were no neonatal problems. The mother ceased breastfeeding the infant at 10 days of life and changed to formula because he did not seem to...

TABLE 58 Types of Cataracts

Congenital (formed in utero or during infancy) 1. Polar Anterior or posterior (axial area) of the lens capsule appears as fine white dots Gray round opacities surrounded by a dark, clear zone can occur in pre- or postnatal development Presenile (formed during early childhood young adulthood) 1. Coronary Wreath of opacities in periphery of cortex Senile (appearance generally following ages 30 to 40) 1. Nuclear Sclerosis (NS) Lens nucleus normally hardens with age index of refraction of nucleus...

The case of the shrinking alligator penis

It was reported that the alligator population of Lake Apopka in northern Florida was declining, presumably because of lack of success in reproduction. The male animals were found to have abnormal testes, low testosterone levels, and small phalli (penises). The female alligators had abnormalities too and high levels of oestrogen. It is believed that high levels of organochlorine compounds, resulting from a spillage of the pesticide difocol, were responsible. The difocol was contaminated with...

Classified List of Fat Replacers and Their Applications

The following table groups fat replacers according to the classification presented in Chapter 1 (Section 1.4.2). In each group, the fat replacers are listed in alphabetical order of their trade names (or common names). This should enable the reader to easily locate a particular fat replacer in the table. It should be noted that, while registered trademarks are not included in the table, the majority of the trade names do in fact carry registered trademarks and the ownership of these belong to...

Candida Torulopsis glabrata

C. (Torulopsis) glabrata is a vaginal yeast infection that causes vulvar burning. Typically, women describe constant vulvar burning without an associated increase in vaginal discharge. Usually, these women have seen multiple providers and tried many over-the-counter as well as prescription medications without relief. On vulvar examination, the genitalia can appear normal or there can be generalized erythema. Microscopic evaluation of the vaginal discharge may be normal or numerous budding...

Ye poysoning of Sir Thomas Overbury

The most famous murder committed with mercury was that of the poet Thomas Overbury. He survived four attempts to poison him and was only killed when he was given an enema containing corrosive sublimate. He was dead within hours. Rapid death from mercury can occur and there are cases on record of people dying of heart failure after being given a mercury-based medicine. Clearly some people are particularly sensitive to this metal, but Overbury was not one of them. He had already survived at least...

Basic Hostility and Basic Anxiety

Horney (1950) believed that each person begins life with the potential for healthy development, but like other living organisms, people need favorable conditions for growth. These conditions must include a warm and loving environment yet one that is not overly permissive. Children need to experience both genuine love and healthy discipline. Such conditions provide them with feelings of safety and satisfaction and permit them to grow hi accordance with then real self. Unfortunately, a multitude...

The poisoning of George III

During his long reign from 1760 to 1820, King George III had several attacks of an unusual illness. Most of these were mild, but some of them involved mental disturbances that alarmed his family and his Government ministers. The minor illnesses of 1762, 1790, and 1795, were free from such madness, as was the more serious attack of 1765 when he was 26 years old. However, the attacks of 1788, 1801, 1804, and 1810 were all accompanied by alarming mental disturbances. The illness of 1788 was the...

Functional Hearing Loss in Children

Functional hearing loss (FHL) is frequently forgotten or misdiagnosed in the pediatric population, despite the fact that it is well documented (Bowdler and Rogers, 1989). The diagnosis is often missed in children because of lack of awareness of its manifestations (Pracy et al., 1996), its incidence (Barr, 1963), and its multiple causes (Broad, 1980). Functional hearing loss is one of several terms used to describe a hearing loss that cannot be ascribed to an organic cause (Aplin and Rowson,...

Externalization Projection of Inner Conflict

In the fourth major adjustment strategy, the neurotic projects inner conflicts onto the outside world, a process Horney called externalization. Externalization refers to the tendency to experience internal processes as if they occurred outside oneself and, as a rule, to hold these external factors responsible for one's difficulties (Horney, 1945, p. 115). It includes the defense mechanism of projection, as traditional psychoanalysis understands it, in which our own unacceptable tendencies (such...

Psychohistorical Study of Hitler

Following Freud (see Chapter 2), Fromm examined historical documents in order to sketch a psychological portrait of a prominent person, a technique called psyc-hohis-toiy orpsychobiography The subject of Fromm s most complete psychobiographical study was Freud (Fromm, 1959), but Fromm (1941, 1973, 1986) also wrote at length on the life of Adolf Hitler. Fromm regarded Hitler as the world s most conspicuous example of a person with the syndrome of decay, possessing a combination of necrophilia,...

Margaret Mahlers View

Margaret Schoenberger Mahler (1897-1985) was bom in Sopron, Hungary, and received a medical degree from the University of Vienna hi 1923. hi 1938, she moved to New York, where she was a consultant to the Children's Service of the New York State Psychiatric Institute. She later established her own observational studies at the Masters Children's Center in New York. From 1955 to 1974, she was clinical professor of psychiatry at Albert Einstein College of Medicine. Mahler was primarily concerned...

Natural Sign Language Versus Artificial Signed Versions of Spoken Language

In several countries, signed versions of the native spoken language have been created by educators. Unlike natural sign languages, they are typically signed simultaneously with the spoken language as a form of sign-supported speech. In the United States there are several versions of manually coded English (MCE). The most widely used of these are Signed English, Signed Exact English, and Seeing Essential English. These all use lexical signs from ASL and English word order, but they vary in the...

Speech Disfluency and Stuttering in Children

Childhood stuttering (also called developmental stuttering) is a communication disorder that is generally characterized by interruptions, or speech disfluencies, in the smooth forward flow of speech. Speech disfluencies can take many forms, and not all are considered to be atypical. Disfluencies such as interjections (um, er), phrase repetitions (''I want I want that), and revisions (I want I need that), which are relatively common in the speech of normally developing children, represent normal...

Concept of Humanity

Horney's concept of humanity was based almost entirely on her clinical experiences with neurotic patients therefore, her view of human personality is strongly colored by her concept of neurosis. According to Horney, the prime difference between a healthy person and a neurotic individual is the degree of compulsivity with which each moves toward, against, or away from people. The compulsive nature of neurotic trends suggests that Horney's concept of humanity is deterministic. However, a healthy...

The medical uses and commercial abuses of thallium

Thallium salts were once part of the medical pharmacopoeia, and used to remove hair. This unusual effect of thallium was discovered by accident in the 1890s when thallium was tested on tuberculosis patients as a cure for night sweats. It didn't stop them having them, but their hair fell out. Dr R. J. Sabourand, the chief dermatologist at the St Louis Hospital in Paris, reported this side effect in 1898 for a while he used it specifically to remove body hair from those with ringworm but gave up...

The Clitoris and the Orgasm

In most species in which males have a penis, females have a homologous organ called the clitoris. Homologous means that both organs grow from the same kinds of cells in the fetus. Anatomically, the human clitoris has the same three-part columnar structure as the penis a glans, a shaft, and bifurcating roots. The main differences are that the penis is much larger overall, its shaft protrudes much more from the pelvis, it keeps blood from flowing back out when aroused, and it has a tube down the...

Examples of Evolved Psychological Mechanisms

Sexual attraction based on physical appearance Sexual attraction based on male's ability to provide resources functions to help ensure males that they are the genetic fathers of their mate's child functions to ensure a healthy mate and one with effects of hormones (estrogen or testosterone) that indicate fertility functions to ensure females that their mates will be able to provide resources needed for the survival of their children functions to optimize the number of remaining years of...

Differential Diagnosis

The diagnosis of any stage or phase of syphilis can be complicated, especially in the setting of HIV. In primary syphilis, the hallmark symptom is a painless lesion usually on the external genital. The differential diagnosis would include other STDs such as genital herpes, chancroid, or lymphogranuloma venereum (LGV). Most of these diseases create a painful lesion or local lymphandenopathy. The lesions associated with secondary syphilis can be confused with other skin manifestations, such as...

How triorthocresyl phosphate caused jake leg

Tri-orthocresyl phosphate (TOCP) is an organophosphate used as a solvent in industry. It has also been used as an additive for aero engine oil. It causes degeneration of the peripheral nerves (the nerves serving the limbs and hands and feet), a disorder called peripheral neuropathy. This toxic effect is due primarily to a specific interaction between the organophosphate and a particular protein in the nerves, which is an enzyme. TOCP becomes bound to it and then undergoes a change, known as...

Exemption from PLAB test

There are several categories which the General Medical Council will accept other than a pass in the PLAB test. The following categories of doctors may be exempt from taking the PLAB Test. Full Membership of a Royal College Sponsorship through an Overseas Doctors Training Scheme Sponsorship through the British Council Sponsorship through a United Kingdom university - for doctors undertaking research or academic work for which they require clinical access A small number candidates of Postgraduate...

Speech Disorders in Children A Psycholinguistic Perspective

The terminology used to describe speech problems is rooted in classificatory systems derived from different academic disciplines. In order to understand the rationale behind the psycholinguistic approach, it is helpful to examine other approaches and compare how speech problems have been classified from different perspectives. Three perspectives that have been particularly influential are the medical, linguistic, and psycholinguistic perspectives. In a medical perspective, speech and language...

Smoking and Self Concept

Previous research on self-concept and adolescent smoking has tended to find relatively negative self-concepts of smokers compared with nonsmokers. More specifically, smokers have greater disparity between real and ideal self-concepts as well as lower self-esteem (Burton, Sussman, Hansen, Johnson, & Flay, 1989 Webster, Hunter, & Keats, 1994). Because different smokers smoke for different reasons, however, an idiographic approach such as the REP test should be better than the conventional...

Differential Diagnosis of Erythrocytosis and Thrombocytosis

Causes of erythrocytosis and thrombocytosis are reviewed in Tables 56.1 and 56.2. Congenital erythrocytosis is extremely rare. Various mutations that disable the negative regulatory domain of the erythropoietin (EPO) receptor have been identified in autosomal dominantly inherited familial erythrocytosis. Congenital erythrocytosis may also result Table 56.1 Classification of Erythrocytosis EPO receptor hypersensitivity Hypoxia sensor hypersensitivity Acquired Appropriate (chronic tissue hypoxia)...

Perineal Hygiene Among Older Women

Genital hygiene is of particular importance to the health and well being of older women. The consequences of inadequate hygiene vary. Mild skin irritation and fungal or bacterial skin infections become more common in older people who have a diminished capacity to care for themselves. Atrophic vulvovaginitis is prevalent after menopause. Moreover, the risk of pressure ulcers and incontinence dermatitis can be significant when older women suffer impaired mobility and urinary or fecal...

Anatomical Structure Of The Vulva

The vulva consists of the mons pubis, the labia majora and minora, the clitoris, and the vestibule of the vagina. The external urethral orifice is situated in the vestibule, as are the ducts of the mucus-secreting paraurethral and Bartholin's glands. The mons pubis and the outer aspects of the labia majora are covered with hairy skin that is similar to that of the scalp and axillae. The labia majora contain numerous sebaceous glands, along with apocrine glands and eccrine sweat Table 1...

Tissue Structure and Physiology of the Vulva

Feminine Care Clinical Sciences, The Procter & Gamble Company, Cincinnati, Ohio, U.S.A. Department of Dermatology, University of California School of Medicine, San Francisco, California, U.S.A. The vulva is composed of specialized tissue with regional differences in embryonic derivation, structure, and morphology. The vulva comprises the mons pubis, the labia majora and minora, the clitoris, the vulvar vestibule surrounding the urethral orifice and vaginal introitus, and the hymen, a...

The Modulation Corollary

How extensively can a person's constructs be applied to new experiences That is the question addressed by Kelly's 1955 Modulation Corollary The variation in a person's construction system is limited by the permeability of the constructs within whose ranges of convenience the variants lie. p. 77 A construct that can be applied to new elements is called a permeable construct A construct is permeable if it will admit to its range of convenience new elements which are not yet construed within its...

About the Four Systems Anxiety Questionnaire

Psychologists have known for several decades that anxiety is a multifaceted concept. While all of us would acknowledge having experienced anxiety, the reality is that our experience of feeling anxious is probably quite different from how others experience this emotion. Nearly thirty years ago, psychologist Peter Lang proposed three ways in which anxiety can be experienced. The first can be called the cognitive component what people say to themselves or what they report to others. A man with a...

Characteristics of American Sign Language and Other Natural Sign Languages

This entry focuses on American Sign Language (ASL) because it is the natural sign language used in the United States and it has been the most extensively studied. However, many of the issues raised here about the unique properties of natural sign languages and the normal pattern of acquisition of those languages by deaf children exposed to complete and early input apply to all natural sign languages. ASL and other natural sign languages are formally structured at different levels and follow the...

Varicose Veins Quality Of Life Questionnaire

Patients completed the SF-36, the Aberdeen questionnaire, and a set of 25 questions focussing on the symptoms and concerns. The conclusion was that the AVVQ was a valid measure of quality of life for patients pre- and postsurgery. Patients were found to have a significantly improved quality of life six weeks postsurgery. Two studies emerged in 2002 where the AVVQ was used. In a prospective study of 203 unselected patients with CEAP 2-6 who underwent saphenous vein...

Partial Joint Denervation

Partial joint denervation is the concept of preserving joint function and relieving joint pain by interrupting the neural pathway that transmits the pain message from the joint to the brain. Traditional approaches to treating joint pain rely on musculoskeletal approaches to the joint itself and often require joint fusion or total replace ment arthroplasty. The concept of partial joint denervation offers the patient an outpatient, ambulatory operative approach that is join sparing and...

Associated Problems Corneal Hypoxia

Corneal hypoxia lack of oxygen in rigid lenses often causes an area of edema that is central, rather than diffuse as in soft lenses. This central area is round or oval in the case of astigmatism , about 2.00 to 4.00 mm across, and grayish white. Draw or describe and grade any edema that is present. The edema becomes more dense as the condition worsens and may eventually be visible without the slit lamp. The problem may also be accompanied by superficial punctate corneal staining see Corneal...

Ulna Plate Lateral Placement

Technique of Fracture Fixation Principles of Stable Fixation As previously indicated, to obtain maximum function the surgeon must achieve anatomical reduction and stable internal fixation. In general, stable internal fixation may be achieved by internal splinting with intramedullary devices or by compression, using plates. In the forearm, intramedullary devices do not control rotational stability and should therefore rarely if ever, be used (Fig. 9.10). Therefore, compression, with...

Comparison of Safeguarding Tendencies with Defense Mechanisms

Limited mostly to the construction of a neurotic style of life 2. Protect the person's fragile self-esteem from public disgrace 2. Protect the ego from the pain of anxiety 3. Operate only on an unconscious level Chapter 3 Adler Individual Psychology 85 protest. In contrast to Freud's views on women, Adler assumed that women because they have the same physiological and psychological needs as men want more or less the same things that men want. These opposing views on femininity were magnified in...

Values of Self Actualizers

Maslow (1971) held that self-actualizing people are motivated by the eternal verities, what he called B-values. These Being values are indicators of psychological health and are opposed to deficiency needs, which motivate non-self-actualizers. B-values are not needs in the same sense that food, shelter, or companionship are. Maslow termed B-values metaneeds to indicate that they are the ultimate level of needs. He distinguished between ordinary need motivation and the motives of...

Psychophysical Systems

Personality is subject to biological as well as psychological influences. Mind and body are inextricably united. Temperament refers to biologically based differences in personality, often evidenced as emotional reactivity to new or potentially frightening stimuli. It is the basis, for example, of one person's shyness and another's bold adventurousness. Allport accepted the empirical research available in his day indicating that temperament constitutes an inherited biological foundation for...

What Is the Role of Conscious Motivation

More than any other personality theorist, Allport emphasized the importance of conscious motivation. Healthy adults are generally aware of what they are doing and their reasons for doing it. His emphasis on conscious motivation goes back to his meeting in Vienna with Freud and his emotional reaction to Freud's question And was that little boy you Freud's response carried the implication that his 22-year-old visitor was unconsciously talking about his own fetish for cleanliness in revealing the...

Characteristics of Instincts

Because Freud understood all personality functioning as derived from instinctive energy, knowing the fundamental principles regulating instincts provides a basic framework for understanding personality. These can be summarized as four basic aspects of instincts source, pressure, aim, and object. 1. Source. All psychic energy is derived from biological processes in some part or organ of the body. There is no separate, exclusively mental energy. The amount of energy a person has does not change...

Measuring Self Actualization

Shostrom (1974) developed the Personal Orientation Inventory (POI) hi an attempt to measure the values and behaviors of self-actualizing people. This inventory consists of 150 forced-choice items, such as (a) I can feel comfortable with less than a perfect performance versus (b) I feel uncomfortable with anything less than a perfect performance (a) Two people will get along best if each concentrates on pleasing the other versus (b) Two people can get along best if each person feels...

Biography of Erik Erikson

Who was Erik Erikson Was he a Dane, a German, or an American Jew or Gentile Artist or psychoanalyst Erikson himself had difficulty answering these questions, and he spent nearly a lifetime trying to determine who he was. Born June 15, 1902, in southern Germany, Erikson was brought up by his mother and stepfather, but he remained uncertain of the true identity of his biological father. To discover his niche in life, Erikson ventured away from home during late adolescence, adopting the life of a...