Genetic Maladies

A recent biography of Sir Archibald Garrod is A. G. Bearn, Archibald Garrod and the Individuality of Man (New York Oxford University Press, 1993). 2. Given the huge numbers of DNA polymorphisms already observed in human populations, the number of potential genotypes is astronomical. Suppose that a mere two hundred polymorphisms were present (more than an order of magnitude fewer than have been documented to date), each with the minimum possible two alleles. Under the logic of Mendelian...

The Doctrines of Biological Science

Hey mastermind our lives, influencing our physical appearance, health, behavior, even our fears and aspirations. They consti tute our material reason for being for eating and sleeping, warring and loving, hating and caring, forging relationships for procreation. To them we owe our existence on us they depend for continuance. We are their evolutionary inventions, ephemeral and disposable hosts. We have been sculpted unwittingly into who we are by serving their replicative needs, but they too...

Genetic Determinism and the Cyril Burt Affair

Few topics in biological determinism have been more controversial than that of the measurement and interpretation of variation in human cognitive ability. In 1909, a young British scientist named Cyril Burt published the first in a series of highly influential papers promoting the notion that variation in human intelligence was male bonding locus backyard football beer-belly biathlon golf, poker vehicular attraction cluster (VRROOM) gadgetry locus (GAD) power tools (PT) personal computers (MAC)...

New Lords of Our Genes

I recommend this book as an introduction to the scientific history of genetic engineering (New York Norton, 1995). 2. Not all infectious plagues are behind us. Outbreaks such as AIDS, various influenzas, Legionnaires' disease, toxic shock syndrome, and Lyme disease provide powerful reminders that modern societies remain subject to major disease epidemics. 3. For example, the restriction enzyme EcoRI, named after the bacterium Escherichia coli from which it was isolated, cleaves duplex DNA...

Reproductive Tinkering

Can a sterile man, unable to produce mature sperm, nonetheless father healthy children Thanks to breakthroughs in human reproductive technology, the surprising answer is yes. A recent clinical case involved an infertile man suffering from azoospermia, a common condition often of genetic origin (involving, for example, microdeletions in the Y chromosome). Fatherhood was accomplished by a medical procedure, intra-cytoplasmic sperm injection (ICSI), which involves the isolation and microinjection...

The Atomization of Human Behavior

Although genetic influences on many aspects of human cognition are mediated and modulated by culture, one research tradition is to consider the possibility of more direct mechanistic connections of particular behavioral traits to particular genes. Such causal links, if identifiable, would once and for all establish direct genetic contributions for such traits, and also might offer prospects for interventions of the sort described in the next chapter. Initial research has focused on attempts to...

Info

Synthesis Somatotropin Flowchart

AATTCGCTAAAGGCTTTATGCGCTG I AATT ligase enzyme pastes DNA fragments together Figure 7.1 The cut and paste operations of recombinant DNA technology. First, a restriction enzyme is used to snip up native DNA from a source such as human tissue. Foreign DNA from another source is also snipped. The snipping operations create sticky ends on the restriction fragments. Then, the native and foreign DNA fragments are mixed together in a test tube with ligase enzymes. The sticky ends of DNA clasp one...

Genetic Sovereignty

Such possibilities certainly were not lost on Charles Darwin, who in 1872 published The Expression of the Emotions in Man and Animals (reprinted by the University of Chicago Press, 1965), a book that attempted to extend principles developed in On the Origin of Species to the fields of human ethology and psychology. 2. See R. C. Lewontin, S. Rose, and L. J. Kamin, Not in Our Genes (New York Pantheon Books, 1984). 3. L. S. Hearnshaw, Cyril Burt Psychologist (London Hodder and Stoughton, 1979)....

The Chromosomal House of Horrors

To emphasize the troubling scientific and providential enigmas presented by human genetic disorders, and to illustrate the pervasive scope of conditions affected by pernicious genes, I will next describe briefly a few of the more common or gruesome afflictions from the morbid encyclopedia of the human genome. For each, mutations in one or more genes on a human chromosome result in the debilitating diseases mentioned. Chromosome 1 hypophosphatasia This genetic defect in skeletal mineralization...